michealponds91 michealponds91

07-07-2022
History

contestada

For what reasons were many colonies granted independence after World War II? Check all that apply

Respuesta :

malikbudescu malikbudescu

07-07-2022

Answer:

recognition of universal human right,pressure from the united nation,economic growth in Europe,growth of nationalism promises made to colonies during d war

Answer Link

Otras preguntas

At the end of Poe's short story, Montresor: successfully got his revenge on Fortunato. was punished for his crime. and Fortunato became good friends and drank

Suppose you are working with a data set that is normally distributed, with a mean of 350 and a standard deviation of 43. Determine the value of x from the follo

A student has two solid blocks that have different masses. The student knows that each block is composed of a pure substance, but she wants to know if the block

The West Germans rebuilt their country A. with aid from the Soviet Union. B. by building new factories. C. by lowering the taxes paid by their citizens. D. thro

SO₂ and CO₂ gives different observations when passed through :a. lime waterb. baryta waterc. acidified KMnO₄d. dil HCI

In which of the following pairs, both the species have the same hybridisation?(I) SF₄,XeF₄ (II) I₃⁻,XeF2 (III) ICl₄⁺,SiCl₄ (IV) ClO₃⁻,PO₄³⁻A. I, IIB. II, IIIC.

What is the dominant species of the indicator when the solution is acidic [H ln(aq') or ln⁻ᵃᵠ color)?

You observe that the average wage paid to employees in a given industry has increased. At the same time, employment in this industry has also increased. What is

Of the DNA sequences below, which would probably be the harder to determine? a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA b) CGATATATATATATACGATGGCATCACGAGCTGCA

The maximum kinetic energy of photoelectrons emitted from a surface when photons of energy of 6eV fall on it is 4eV. What is the stopping potential (in volts)?

Q&A Platform for Education Platform Explore for Education