jasminestewart5142 jasminestewart5142

06-04-2024
Biology

contestada

Of the DNA sequences below, which would probably be the harder to determine?
a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA
b) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA

Respuesta :

Otras preguntas

Find geometric sequence 4,16,64,256,1024

Six-year-old Fabian likes to fix things with his Dad around the house. He grabs his toy tools and sometimes even picks up a real screwdriver to try and help Dad

1. Solve the following system using the substitution, elimination, or graphing method for the y coordinate. x= -4y+3 -x-4y=-3

A bag contains 20 pieces of candy. There are 8 grape peices, 7 cherry pieces, and 5 lemon pieces. part a says that one piece is drawn from the bag. find the The

over the summer, Jose collected used books to distribute to 15 Twig libraries in Chicago. At the beginning of the summer, he started out with 40 book. He collec

Why is romeo happy when we first see him in mantua?

An item is regularly priced at $30 . it is on sale for 60% off the regular price. how much (in dollars) is discounted from the regular price?

who was the first under British throne to cross the Atlantic

99 POINTS Read the sentence and select the correct answer. Participial phrases and participles function as adjectives in sentences. True False

The 16 broad career options developed by the U.S. Department of Education are called: A. work-study programs. B. education careers. C. school-to-work