boiineedhelp1 boiineedhelp1

10-01-2017
Social Studies

contestada

In 509 B.C., Rome became a republic. Which of the following is a characteristic of a republic?

Respuesta :

TessaElaine TessaElaine

10-01-2017

A republic votes, they elect their officials, it is politically and economically stable.

Answer Link

Otras preguntas

The word ___________ is used to describe several types of computer hardware, all of which might by found in a typical electronic commerce operation.

Paige is paid every other Friday at her job. In operant conditioning terms, Paige is on a fixed-interval schedule of reinforcement.a. Trueb. False

19) Write the equation of any line URGENT URGENT URGENT URGENT URGENT URGENT URGENT UGRENT URGENT URGENT UGRENT Write the equation that is perpendicular to th

A baseball player throws a ball, and the height of the ball (in feet) can be approximated by y(x)=-0.012x^2+0.375x+5 where x is the horizontal position of the

6. Based on Matshikiza’s response to D’Souza in this column, what do you infer are D’Souza’s views on colonialism and the rise of the West? Justify your answer

The ACA group of ethics would likely consider which part of the following to be ethical on the part of a group leader? a) Discriminating based on age b) Providi

What is the coordinate of b if an is 3/7 of ac if a=(-18,-17) and c =(3,11)

what are the similarities between a father and the mahdar iqbal.

The magnetic of filed lines of solenoid are similar to the magnetic field lines of bar magne image correctly shows the solenoid as a bar magnet?

Of the DNA sequences below, which would probably be the harder to determine? a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA b) CGATATATATATATACGATGGCATCACGAGCTGCA

Q&A Platform for Education Platform Explore for Education