cayy2
cayy2
09-11-2016
Mathematics
contestada
Find AM in the parallelogram if PN=9 and AO=4
Respuesta :
worksited
worksited
09-11-2016
Diagonals of a parallelogram bisect each other. It is not relevant that PN=9. since AO=4 then AM=4
Answer Link
VER TODAS LAS RESPUESTAS ( 85+ )
Otras preguntas
A train traveled at the same speed for 2 hours. It went 98.9 miles in all. How fast was the train going?
The story Las Vacaiones. Desde cuando estaba manuel su famila en la playa
Which two statements below are central ideas in the article, “How Gross Is Your Bathroom”? Grupo de opciones de respuesta What you can’t see might hurt you.
From this passage, the reader can tell that Charlie is A. trustworthy. B. childish. C. careless. D. focused.
The test of eye fatigue has a mean of 15 and a standard deviation of 5. using a normal curve table, what proportion of students have score above 16?
Of the DNA sequences below, which would probably be the harder to determine? a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA b) CGATATATATATATACGATGGCATCACGAGCTGCA
Which of the following would be an example of the role ot could have in health promotion/prevention? 1) Conducting health education programs 2) Administering va
a patient with a mild foreign body airway obstruction: is typically not cyanotic presents with a weak cough has a low oxygen saturation
Use generating function to find the number of ways rs 23 can by paid by using 4 coins of rs 5, 6 coins of rs 2 and 4 coins of rs 1.
2. Escribe F (falso) o V (verdadero) de acuerdo con el contenido de cada afirmación. a . En Cien años de soledad, no aparecen elementos imaginarios. ( ) b. Los
Q&A Platform for Education
Platform Explore for Education
