juniordecember juniordecember

09-04-2018
English

contestada

None of the items advertised can be ( )

( 1 ) used
( 2 ) eaten
( 3 ) cleaned
( 4 ) displayed

Would u help me??

None of the items advertised can be 1 used 2 eaten 3 cleaned 4 displayed Would u help me class=

Respuesta :

09-04-2018

The answer is (2) eaten, because you can use, display, and clean art, baskets, doormats, and lamps, but you can’t eat any of them.

Answer Link

Otras preguntas

which component of cpu controls the overall operation of computer..

2x + 11 = 25 Solve x I need the working out.

Select each expression that is equivalent to 4n+12 A. 16n B. 2n+6+2n+6 C. 2(2n+4)+2 D. 4(n+3) E. 3(n+4)+n F. n+n+n+n+12

Which statement in this excerpt from Robert Louis Stevenson treasure island reveals Long John Silver's capable of controlling his emotions

I need help with these questions

(4x−1) al cuadrado =20x−5

Instructions: Find ZJ if YJ = 24. Confused...help please

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Homeless in New York, after reading the tited , the best question would be ?

PLEASE HELP ASAP!! CORRECT ANSWER ONLY PLEASE!!! Whitney’s employer contributes to the employees’ 401(k) plans as part of its benefit package. The company will