itssmikey118
itssmikey118 itssmikey118
  • 08-03-2017
  • History
contestada

How did columbus spark American immigration

Respuesta :

Аноним Аноним
  • 08-03-2017
He sailed the ocean blue in 1892. He inspired others to do the same.
Answer Link

Otras preguntas

How was victor changed by the end of Frankenstein
which part of the photosynthetic cycle does not require sunlight?A. chemosynthesisB. Light reaction C. Photon collisionsD. Calvin cycle
What are two methods you can use to tell if 2 functions are inverses of each other?
How to convert 3x-5y=6 to slope intercept form
!*!*!*!**!* ANSWER QUICK *!**!*!*!*! A scientist is examining a single-celled organism with no nucleus that can be found in extreme environments. What kingdom d
Last week Ella scroed 8 baskets. This week she made twice as many. Howmany baskets sis she make this week.
Solve for b. 8b−1=24b+4
What was true about Jackie Robinson?
On a bus 40% of students have a backpack.If there are 10 students with a backpack,how many total students are on the bus?
5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand