Superllama
Superllama Superllama
  • 07-03-2017
  • Mathematics
contestada

System of substitution
Y-9=-x
3x-y=7

Respuesta :

PsychoChess
PsychoChess PsychoChess
  • 07-03-2017
3(y-9)-y=7
3y - 27 -y = 7
2y = 34
Y = 17

3(x) -17 = 7
3x = 24
X = 8

Answer Link
Аноним Аноним
  • 07-03-2017
1.  X = 9 - Y

2. X = 7+y/3

I really hope this helps. :)
Answer Link

Otras preguntas

Which sentence states a fact about ostriches? A They are not ordinary birds. B Their feathers are beautiful. C They are remarkable birds. D They eat what they
AUUUAACUGUUCUGUCUAGAG 1. Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of
Consider the expressions (3m+2n−6) and (−4−6m+7n). What is the sum of the expressions for n = -2 and m = 5?
Write any two ways to avoid scurvy.​
g each collectible ship requires one pint of high-quality paint at a cost of $25 per pint. considering increasing the selling prices of both models by 7.5%, whi
1/2n + 2n + 3/2n - 1
3(b + 3) = 2a + 27 SHOW STEPS FOR BRAINLIEST
which describes a number that cannot be irrational?
What genre is "The reign of Attila the Hun" by Ed Reaves
A water sprinkler sends water out in a circular pattern. How large is the watered area if the radius of the watering pattern is 12 ​ft?