lauryeakle23 lauryeakle23

06-03-2017
Mathematics

contestada

Write an algebraic expression for two numbers with a sum of -6 let one of the numbers be represented by x

Respuesta :

SkyeBird13 SkyeBird13

06-03-2017

I believe this is what you need:
x + -4 = -6 (Where x is represented by -2.)

Helpful? :D

Answer Link

Аноним Аноним

06-03-2017

I think the answer is -2

Answer Link

Otras preguntas

Why did the united states and its western allies stop the construction of the Berlin Wall or the repression of the Hungarian Revolution? A.) they thought the So

Why do you think Miller uses this unusual expository strategy for his drama? Its from the Crucible.

which of the five civilized tribes managed to stay on their tribal lands even though after the indian removal act was signed long after 1832?A. CreekB. Muscogee

what is 4 divided by one seventh

can someone help me with triangle proofsWill report fake comments. Really need help with understanding how to do it

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Nina has 2 cups of flour. However, this is only 1/4 of the amount of flour that she needs for a bread recipe. How many cups of flour does the recipe call for?

Which statement describes the motion of the sun? a: The sun rotates at the same rate throughout. b: The sun does not rotate at its poles. c: Different parts of

Please help me with this question! ASAP

what is the difference between fast-twitch and slow-twitch muscle fibers.