emmmmmmm
emmmmmmm emmmmmmm
  • 08-02-2017
  • Mathematics
contestada

Which equation is equivalent to 3=87/h

Which equation is equivalent to 387h class=

Respuesta :

life1234514a life1234514a
  • 08-02-2017
8 5/9 hope thats correct mark as brainliest pls


Answer Link

Otras preguntas

Which of these viruses can spread to the eye to cause a form of keratitis? human papillomavirus herpes simplex virus 1 parvovirus 19 circoviruses
Why is it impossible for humans to digest food that contains cellulose?
Your favorite candy bar, Gummy Beakers, contains 1.2 x 106 J of energy while your favorite soft drink, Bolt, contains 6.7 x 105 J. If you eat two packs of Gummy
What experimental evidence led to the department of this atomic model from the one before it ?
An example of a monosaccharide is ________. fructose glucose galactose all of the above
Why don’t lunar eclipses happen during every full moon?
Which of the following is a characteristic of a perfectly competitive​ market? A. a large number of firms in a market B. selling a standardized product C. no ba
A line passes through the point (4, –6) and has a slope of -3/4. Which is the equation of the line? y=-3/4x-3 y=-3/4x-6 y=3x-3/4 y=6x-3/4
In the famous conditioning experiment, Pavlov demonstrated that his dogs started drooling in response to a bell sounding. What part of the digestive process did
A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is