morganbaily0 morganbaily0

08-02-2017
Biology

contestada

Which of these is NOT one of the three challenges of life? A. Reproducing B. Obtaining Energy C. Running D. Maintaining Structure (homeostasis)

Respuesta :

Аноним Аноним

08-02-2017

C. Running. Running is not a challenge of life.

Answer Link

Otras preguntas

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?

At the end of the first year of operations, the total cost of the trading securities portfolio is $245,000. Total fair value is $250,000. The financial statemen

Organisms produce their own energy or provide energy for other organisms in a food chain. Many different organisms can be found in the Amazon rainforest in Sout

Mathematicians come thru wit da help

To understand an unknown words meaning a student should A. Use context clues B. Determine the words part of speech C. Study the word affixes D. All of the cho

how do skill ,type of job and demand for products affect wages?

2(6-x)-(9x+2)=4+8(x-4) X= ?

Having hair on the back of the hand is a dominant traitand not having the hair is a reccesive trait Which set of parents will have only children without hair on

The sum of two numbers is 7 and there difference is 5

Kim rolls a dice and flips a coin a) Calculate the probability that she gets a 2 and a head b) Work out the probability that she gets an even number and a tail

Q&A Platform for Education Platform Explore for Education