amillscpc1970 amillscpc1970

08-06-2022
Biology

contestada

How can inheritance of traits affect a crop’s ability to survive disease?

Respuesta :

avaslong11 avaslong11

08-06-2022

less genetic variation in the inheritance of traits causes a crops ability to be more prone to disease because there are less alleles immune to disease in the genetic pool

Answer Link

Otras preguntas

Help I don’t know the answer

Describe two advantages of genetic engineering. (4 points)

BRAINLIEST!!PLEASE HELPMEEE!

25 pt question amd will mark brainliest

What exactly is Nativism?

what is an advantage and disadvantage to file compression

if 12 1/2% of a sum of money is $40 what is the total sum of money?

A formatted printout (or screen display) of the contents of one or more tables or queries is a form. _________________________ a. True b. False

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

The expression means 15 minus the product of 5 times the difference of p minus 6. If p = 8, then the value of the expression is . ©