nikibanana123 nikibanana123

08-06-2022
Mathematics

contestada

People in two sample groups were asked to identify their favorite kind of pizza. study the results and circle a generalization

People in two sample groups were asked to identify their favorite kind of pizza study the results and circle a generalization class=

Respuesta :

wesleyrefro11 wesleyrefro11

08-06-2022

Answer:

Group B

Step-by-step explanation:

You can see even with the same total group b likes the most topppings

Answer Link

Otras preguntas

The point (0, 0) is a solution to which of these inequalities? A. Y - 7 < 2 x - 6 B. Y - 6 < 2 x - 7 C. Y + 7 < 2 x - 6 D. Y + 7 < 2 x + 6

A 10-year bond, with a par value equaling $1,000, pays 7% annually. If similar bonds are currently yielding 6% annually, what is the market value of the bond? U

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?

A pulley with a mechanical advantage of 5 will require you to pull _____ times the amount of rope. A. 1/5 B. 5 C. 10 D. 15

Listed below are student evaluation ratings of courses, where a rating of 5 is for "excellent." The ratings were obtained at one university in a state. Constr

Carr Company is considering two capital investment proposals. Estimates regarding each project are provided below: Project Soup Project Nuts Initial investment

If there were 2,000 units of biomass among the primary producers of a food chain, how much biomass would be expected among the tertiary consumers in that same f

After receiving information on various forms of birth control, a young couple decides to use a barrier method because they would like to try and conceive in a y

A manufacturer of specialty jams and jellies has decided to ally itself with an orchard and vineyard growing rare strains of fruit. This is a(n) __________ stra

PLEASE I NEED HELP I NEED TO TURN THIS IN ON MONDAY If the sentence is true, write true. If the sentence is false , replace the underlined word to make the sen

Q&A Platform for Education Platform Explore for Education