TictokGlodenMaster
TictokGlodenMaster TictokGlodenMaster
  • 06-05-2022
  • Health
contestada

This type of cell acts like a Pac Man eating and destroying bacteria and other pathogens.

a
Phagocyte
b
Erythrocyte
c
Antibody
d
Mast Cell

Respuesta :

abbymp2019 abbymp2019
  • 06-05-2022

Phagocyte (A)

im pretty sure is Phagocyte (A). this kind of cell englufs other bacteria and pathogens kind of like pacman does.

Answer Link
johnsonxoo johnsonxoo
  • 09-05-2022
It’s A Phagocyte!!!
Answer Link

Otras preguntas

A scale model of a giant robot is 24 centimeters high, with an arm length of 12 centimeters. The height of the real robot is 6 meters. What is the arm length of
how do i make 0.82 into a fraction
but is the answer A, B, C, or D
House's cross-cultural work focused on workplace ____________, while hofstede's work focused on workplace
A position in society that cuts across other statuses a person holds, such as being a high-ranking army officer, a college president, or a handicapped olympian,
what does molecules form or make
Between muncie and anderson, the drainage area of the white river increases by _________.
What were the effects of the geographic obstacles that separated Americans before the transportation revolution?
To which of the following DNA sequences would the TATA box binding protein bind? A. TAGGCGTATATAGCGCCTTAT B. CCCGTTAATTAATTAACGCGC C. GCGCTTATCTATTACCGTACG D
Dr. james deliberately varied facial symmetry in a series of photographs and later measured participants' liking for the faces. which type of research method di