zackywacky32 zackywacky32
  • 10-12-2021
  • Mathematics
contestada

(-x + 3) + (4x - 10)

Respuesta :

infermiteg infermiteg
  • 10-12-2021
the correct answer is 3x-7
Answer Link
lilyqueen2356 lilyqueen2356
  • 10-12-2021
this is so simple, 3x-7
Answer Link

Otras preguntas

Which inequality represents all numbers x on a number line that are farther from −8 than from −4?
What is the volume of the cylinder below? 6 7 4A. 96pie units³B. 168pie units³C. 84pie units³D. 112pie units³​
Someone please answer this ASAP I’m in the middle of an exam 25 points!
Find the value of x.
Does anybody know the Correct answer to this i'm marking brainliest !! I can't find the subject but this question is from music class .
You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATTGTTCGGCAAATAAAAATAA Wha
What happens when traits are not dominant or recessive
Find the mean absolute deviation of the following numbers. 10, 8, 5, 12, 20
A college uses advisors who work with all students in all divisions of the college. The most useful allocation basis for the salaries of these employees would l
Explain the term humans right​