manMarTinapaparinc manMarTinapaparinc
  • 11-01-2017
  • Mathematics
contestada

What is 1359 divided by 37?

Respuesta :

LegitGurl LegitGurl
  • 11-01-2017
1359 divided by 37 is 36.7297297
Answer Link
jennetkara
jennetkara jennetkara
  • 11-01-2017
1359/37 = 36.7297297297

36.7297297297 = 367.297297297 to the nearest tenth

36.7297297297 = 36.73 to the nearest hundredth

36.7297297297 = 36.73 to the nearest thousandth

= 0 to the nearest tenth

= 0 to the nearest hundredth

= 0 to the nearest thousandth




Answer Link

Otras preguntas

I need sentences for my Spanish 2 HW please
what's the answer to this
5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
Pls help :) i will be very happy
My arm healed quickly which tense
Think about the communities property of real numbers operations as it applies to addition and subtraction of functions.how do you think this property might exte
Hans and sybil eysenck described personality differences by identifying
In 2014, the European Space Agency’s Rosetta mission landed on comet 67P/Churyumov-Gerasimenko. The spacecraft detected the presence of water ice on the comet.
Little sister needs help, can anyone explain this to her? If Ben reads 8 pages in 12 minutes what is his ratio of pages to minutes in simplest form?
CHALLENGE : Figure out this riddle... I have two legs, but they only touch the ground while I'm at rest. What am I?