215vxmpire 215vxmpire
  • 06-10-2021
  • Mathematics
contestada

Somebody help me please

Somebody help me please class=

Respuesta :

minmelonie392 minmelonie392
  • 06-10-2021

Answer:

c

Step-by-step explanation:

Answer Link

Otras preguntas

Which function would be produced by a horizontal stretch of the of y=
Which transformations were used to create A’B’C’? 1. Dilation by a scale factor of 1/2 and a reflection across the Y axis 2. Dilation by a scale factor of 2 and
What does the metaphor " ribbon stretching to the horizon” means?
Help! Will mark brainest!
Please answer quickly!!! 15 points!!! James addressed his Epistle to: Galatians Samaritans Gentiles Jews in Jerusalem Jews who were scattered abroad
What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
if the guarantee against self incrimination were removed from the constitution, what might be the effect on the criminal justice system
The theory behind high-protein, low-carbohydrate diets is that carbohydrates signal the body to produce _______ which in turn signals the body to store extra en
Read each sentence. Underline the simple subject. Then circle the word in the predicate that is linked to the subject by the verb
what is 7 lb 4 oz converted to ounces?