mrztykme mrztykme

10-09-2021
Chemistry

contestada

Which is an unreliable source? HURRY

Which is an unreliable source HURRY class=

Respuesta :

72540971 72540971

10-09-2021

Answer:

An Advertisement for acne medication claims it can clear up acne in less than one week

Explanation:

Answer Link

bellephillips bellephillips

10-09-2021

Answer:

B an advertisement for acne medication claims it can clear acne in less than one week

Answer Link

Otras preguntas

what is the height of the beach sign?and what is the height of the beach umbrella?I'm not sure if both images were attached, oops. but please help! I'll mark as

Motivation for imperialism in all of Africa and the Congo had political economic and social causes what is the causal relation for these factors

A statistical study concluded that the average fan at a typical sporting event spends approximately $7.50 on concessions. if only one vendor is licensed to sell

what is a contour interval

Fernando has a bucket that holds 3 gallons of water.he is filling the bucket using a 1-pint container.how many times will he have to fill the pint container in

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

"what would happen to the range of cattle if the tsetse fly was eradicated"

In rotation, which point is moved the greatest?

A steady supply of _________ is needed throughout the body in order for electrons to be accepted at the end of the electron transport chain.

YOoooO help muuee.?!?.!??.!?.