Seudónimo Seudónimo

10-09-2021
Mathematics

contestada

square root of 161 need answer asap ik this has nothing to do with math but being single is pain

Respuesta :

lydiabrownies12 lydiabrownies12

10-09-2021

Answer:

12.6885775404

Step-by-step explanation:

Answer Link

Otras preguntas

On a phylogenetic tree, which term refers to lineages that diverged from the same place? sister taxa basal taxa rooted taxa dichotomous taxa

The natural abundance of 2h is 0.015% and that of 18o is 0.20%. How many 2h218o molecules are there in 1.0 moles of water?

Give four ways to demonstrate that Earth is spherical.

Which environmental change Played a key role in making human survival easier and bringing about the Neolithic age?

are found only in _____ skin, and detect skin deflection. Meissnerâ€™s corpuscles: hairy Merkelâ€™s disks: glabrous hair receptors: hairy Krause end bulbs: hair

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is

Compare the lifestyles of hunter-gatherers with those of settlers of early agricultural communities. Which of the following is a true statement about the pictur

Las ventas (sales) de salsa son bajas en los Estados Unidos. cierto falso Corrige la afirmación falsa. Leticia fue a un restaurante ecuatoriano. cierto falso

Drug formulations that include SR, DS, and LA included their brand name are dosage forms that indicate some degree of longer period of drug release in the body.

A sanding disk with rotational inertia 3.8 x 10-3 kg·m2 is attached to an electric drill whose motor delivers a torque of magnitude 17 N·m about the central axi

Q&A Platform for Education Platform Explore for Education