10-12-2016
Mathematics

contestada

What is the area of a triangle whose vertices are j (-2,1), k (4,3), and l (-2,-5)?

Respuesta :

Cakeislifelol Cakeislifelol

10-12-2016

A super easy way of doing this (my geometry teacher is my source) Plot all of the points on a graph, and then, draw the lines until you get a triangle, then, count all of the squares. The amount of squares will be your area.

Answer Link

Otras preguntas

Electrophilic addition of hbr to 3-methyl-2-hexene creates an asymmetric center at c-2. what is the product of this reaction?

what describes an impact cause of world war 1

Read the following excerpt from the Bhagavad-Gita. “For the soul there is neither birth nor death at any time. He has not come into being, does not come into be

if $14871.16 = 1.957% of x, what is x?

To croon means to..... A. speak magic words. B. fly to great heights C. cry out in pain D. sing softly

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

A composer might delve more deeply into a topic, such as the loss of life, by writing in which genre? funeral march solo song song cycle

Booker T. Washington believed that the best interests of African American people could be achieved through education and learning work related skills. He believ

How has China’s economy change after the death of Mao Zedong

This is a compound sentence: Mrs. Warkentine watched the students complete the homework, and the students did an excellent job. Question 5 options: A: True

Q&A Platform for Education Platform Explore for Education