Seudónimo Seudónimo
  • 08-12-2016
  • Mathematics
contestada

17 please I need help

17 please I need help class=

Respuesta :

Jenny45cal
Jenny45cal Jenny45cal
  • 14-12-2016
800 Area Searched out or 7150 Entire Area
8.9375% Searched Chance of Finding it.
Answer Link

Otras preguntas

What message is Roosevelt trying to convey? A. There needs to be greater effort put into teaching children how to read. B. Libraries are necessary because the
Sierra applies a coat of epoxy paint to the four sides and floor of a rectangular swimming pool. The pool is 4 feet deep, 18 feet long, and 12 feet wide. One ga
Middle school math!! What does the graph tell you about the solution to the system equation?
Which of the following was the origin of today's marathons? the announcement of the Athenian defeat at the Battle of Marathon the announcement of the Athenian
You look at two species and see very similar DNA. What does this likely tell you?
Match each solids with their formula
The perimeter of a rectangle is 80x. The base is 7 times the height. In terms of x, what are the dimensions of the rectangle? a. h = 10x, b = 10x c. h = 3x, b =
You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATTGTTCGGCAAATAAAAATAA Wha
how did the scientific method impact work of scientists in the 16th century?
Hi, kind of struggling rn. Id appreciate a little bit of help and brief explanation