bribri61500 bribri61500

07-05-2021
Mathematics

contestada

HELP ME PWEASEEEEEEEE!!!!!!!!!!!!!!!!1111111111111111111111111111111

HELP ME PWEASEEEEEEEE1111111111111111111111111111111 class=

Respuesta :

Аноним Аноним

07-05-2021

Answer:

3x

hope this helps

have a good day :)

Step-by-step explanation:

Answer Link

shahwalls shahwalls

07-05-2021

Answer:

The slope is 3

Step-by-step explanation:

slope=(rise)/(Run)

rise=3

run=1

so: (3)/(1)= 3

Answer Link

Otras preguntas

Solve using proportions please

mrs fowler was grilling burgers. each burger was 1/4 pound of beef. if she used 5 pounds of beef, how many burgers did she make ????? who ever answer correctly

To remove the sand first and then the salt from a mixture of sand and salt water, one combination of techniques you could use would be to first — a evaporate an

Why is Professor Schlemiel trying to get home? Question 3 options: He is concerned that something is wrong with him because he can't remember anything. His wife

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

PLEASE HELP ME!! 12 POINTS (only if you answer correctly) 1)Why was the House of Burgesses so important? It was the first colonial representative body It was th

After several softball games, Jenni has 12 hits and 5 walks. What is the ratio of hits to walks?

list the five basic relationships of confucianism

What is the empirical formula? A compound is used to treat iron deficiency in people. It contains 36.76% iron, 21.11% sulfur, and 42.13% oxygen. The empirical f

name one advantage (strength) the British had in fighting the war