emi6idonjazz2kbard emi6idonjazz2kbard

10-11-2016
English

contestada

The correctly spelled word is
a. coolly.
b. superintendant.
c. procede.
d. arguement.

Respuesta :

misanthropy misanthropy

10-11-2016

the answer is
c) procede

Answer Link

Otras preguntas

what is -5k+k simplified

Adam's father spent 1 hour and 50 minutes working on his truck. If it was 7:35 when he stopped working, what time was it when he originally started?

ella has painting class every 2 weeks. Norah has pottery class every 5 weeks. ella and norah met at the art building for class this week. How many weeks will it

Which individual from the Renaissance is known for writing The Divine Comedy using Italian rather than Latin? A. Cosimo de' Medici B. Dante C.

What are some internal and external reasons to someone might use, or decide not to use, vaping?

If it is 3:07 and 35 minuets past what time would it be?

what is the solution to -sqrt(75) to the nearest integer I will give braniest

If concentrated sulfuric acid is spilled during the experiment, what is the proper procedure for cleaning the spill?

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Please help quickly gets brainliest