zoelacernestinks zoelacernestinks

10-11-2020
Mathematics

contestada

What is the basic ratio of 36:84

Respuesta :

cheystyles cheystyles

10-11-2020

3:7

Step-by-step explanation:

divide them both by 12

Answer Link

emilyemily12302004 emilyemily12302004

10-11-2020

Answer:

3/7

Step-by-step explanation:

you keep simplyfiying until you get to the unit rate.

Answer Link

Otras preguntas

An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication

Please I need it please me

A clothing company has 4 different kinds of sweatshirts. Each year, the company makes 60,000 of each kind of sweatshirt. How many sweatshirts does the company m

A Marine captain is accusing a major news network’s journalist of lying in a story. The journalist, who was with the Marines on patrol, wrote that the helicopte

What connection does the author draw between self esteem and ideal self

Which was an achievement of Jimmy Carter during his time as president?

Read the paragraph. Marco is writing a narrative about his grandmother’s difficult decision to immigrate to the United States. He wants the reader to have acces

The data in the table below for my function. What values in the table would change the relation to NOT be a function? A) (1,9) B) (-3,7) C) (9,4) D) (6,5)

Which of the following is the mostimportant power of the judicial branch?A) Declaring laws and executive actionsunconstitutionalB) Issuing warrants for federal

Which statement best describes why the Roman Empire faced food shortages?