bayley458 bayley458
  • 08-09-2020
  • Medicine
contestada

When a person has food intolerance, his or her immune system will react when the food is eaten and cause the person to become ill. true or false

Respuesta :

zoiemerrifield
zoiemerrifield zoiemerrifield
  • 09-09-2020
True- It causes symptoms, such as bloating and tummy pain, which usually happen a few hours after eating the food.
Answer Link

Otras preguntas

When we experience conflict, it threatens our needs to feel ____? A. Valued B. Needed C. Independent D. Loved
a digital camera cost $185 and the sales tax rate is 5.7%.what is the total cost of the camera after tax. round to the nearest cent if necessary.
How does an ALU perform a logical operation?
State the degree of the polynomial.
which is a property that most nonmetals have in common
What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
Why is India called a subcontinent
Order fractions smallest to biggest 3/4, 1/3, 1/2, 4/6, 5/12
Which is first X axis or Y axis?
Franklin D. Roosevelt’s New Deal programs accomplished all of the following except: Question 3 options: Changed the rules governing the buying and selling of st