mandionengaya mandionengaya

10-07-2020
Mathematics

contestada

The quotient of the sum of 3 and a number and 6 is less than -2

Respuesta :

Stefany333 Stefany333

10-07-2020

Answer: 3 + n / 6 is less than -2

Explanation:

It’s an inequality:

Quotient: division

Sum: addition

A number: the variable, n

Answer Link

Otras preguntas

AUUUAACUGUUCUGUCUAGAG 1. Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of

list out the characteristic of chemical reaction

According to the passage, most people who lived in rural areas had to travel into bigger towns and cities to get their mail. paid more for postage than people i

WILL GIVE BRAINLIEST!! Explain how the phrase “knowledge is power” applies to civics.

What is the nth term of each linear pattern? 85,80,75,70

Marie and her family are on a trip. So far, they have traveled 175 miles and are 25% of the way to their destination. How many total miles will they travel? 44

Evaluate x^2 when x= -2 help!! -2 -4 2 4

Use the following terms in a paragraph: expectations, universal, impression, stereotypes, identity, and knowledge

help please with math decmal

6. Moira has a canvas that is 8 inches by 10 inches. She wants to paint a line diagonally from the top left corner to the bottom right corner. Approximately how