joesiegcorona joesiegcorona

10-06-2020
Chemistry

contestada

What is the mass number of an atom that contains 19 protons, 19 electrons, and 20 neutrons?

Respuesta :

10-06-2020

Answer:

39

Explanation:

Total protons + total neutrons = mass number

Answer Link

Otras preguntas

most firms today compete in mature markets characterized by commoditization. in these cases, the typically becomes incapable of differentiating the product offe

c-14 (radiocarbon) is radioactive and decays into n-14 with a half-life of 5730 years. assume a rock starts with 1000 atoms of c-14. if the rock is 5730 years o

#le passé composé de l’indicatif

which of the following statements about the federal gift tax is false? multiple choice the donor's basis in the gifted property carries over to become the donee

choose the correct answer pls

Help help Will Give BRAINLYST que Necesito para viajar? La major expression entre parentesis para cada oracion underline the best expression to complete the sen

Is the name alda common name?

Which of the following is always positive when a spontaneous process occurs? a. Δ S s y s t e m b. Δ S s u r r o u n d i n g s c. Δ S u n i v e r s e d. Δ H

For this question, use the information given in the situation, as well as your answers to the previous questions. After looking through different hotel options

our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a cha