cristaltejada8
cristaltejada8 cristaltejada8
  • 06-05-2020
  • Health
contestada

An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​

Respuesta :

iveracisneros98
iveracisneros98 iveracisneros98
  • 06-05-2020

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

Answer Link

Otras preguntas

What does the phrase "purpled thy nail" refer to in this excerpt from "The Flea" by John Donne?Cruel and sudden, hast thou sincePurpled thy nail in blood of inn
Dans quel ville Jean Valjean arrive-t-il? En quel année?
Mass varies depending on proximity to earth. true or false
14. What is the mass of 3.5 moles of water?
restate newton's first law in terms of acceleratin
Which Internet connection speed is fastest? A. 1,024 bps B. 1.5 Mbps C. 400 Kbps D. 1,048,576 bps
Kayla earns 6.5% in commissions on her home sales. She also earns a yearly salary of $12000. She would like to earn a total of $45000 per year. What is the tota
How manny times do. 33 gose in to 678
Find each difference. Write in simplest form 7/8-5/8=
What enables one employee to demand a higher salary than another in the same industry?