oliviaenrii
oliviaenrii oliviaenrii
  • 08-04-2020
  • Chemistry
contestada

MATCH UPS - PLEASE HELP ^^photo attachment

MATCH UPS PLEASE HELP photo attachment class=

Respuesta :

Liuleah01 Liuleah01
  • 08-04-2020

Answer:

14. c

15. e

16. b

17. d

18. a

Explanation:

Answer Link

Otras preguntas

Stevens bank account balance was $212 at the beginning of the month he withdrew $63,$74 and $39 he also deposited $105 and $86 what was his balance after these
if you dig a 6 foot hole how deep is that hole????
Solving proportions[tex] \frac{1\3}{5} = \frac{a}{20} [/tex]​
You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATTGTTCGGCAAATAAAAATAA Wha
Microsoft Excel used for making document and presentation.
When a solution is very acidic, what does it have a high concentration of? Hydroxide (OH-) Hydronium (H3O+) Iodide (I-) Acetate(C2H3O2-)
Things that grow in a region that can be used to help or support a group of 1 point people are Resources Groundwater Famine BI hp
PLEASE HELP!! Since September 11, 2001, are there any reasons that personal privacy should be compromised. Explain using specific examples. (One paragraph)
Struggling a little bit would anyone mind explaining?
HELP Decide which groups of words express a complete thought, and put "S" in front of each complete sentence. If the words are only a phrase or dependent clause