kendallblacketer65 kendallblacketer65

10-07-2019
Mathematics

contestada

At the end of 3 years, how much money would you have in total if you invested $75 and earned 5% simple interest?

Respuesta :

panavkotha panavkotha

10-07-2019

Answer:

$86.82

Step-by-step explanation:

y=75*(1.05)^3

y=75*1.157625

y=86.821875

The amount of money after 3 years is $86.82.

Answer Link

Otras preguntas

Which statement about thylakoids in eukaryotes is not correct? Thylakoids are assembled into stacks. Thylakoids exist as a maze of folded membranes. The space s

Many mammals become ill if they drink milk as adults even though they could consume it as babies. What causes this digestive issue?

Add the correct ending to each adjective of origin. If the adjective can be used in both genders, add both. 1. medellin 2. porte 3. hispan 4. costarric 5. pai

Binding of an RNA binding protein will ________ the stability of the RNA molecule. increase decrease neither increase nor decrease either increase or decrease

The variable regions of the heavy and light chains form the ________ sites of an antibody.

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is

are similar to basophils, but reside in tissues rather than circulating in the blood.

Scientists study 200 adults who have type 2 diabetes, and 200 adults who have similar characteristics but do not have the disease. For 18 months, the researcher

Solve each equation by elimination. d. y = x² - 4x + 7 y = -x + 11

Explain the difference between plasma and the formed elements of the blood.