Seudónimo Seudónimo

02-03-2016
English

contestada

Which is the best definition of personification
a) giving animals and objects human characteristics
b) developing new characteristics of personality
c) giving yourself the characteristics of someone else
d) giving human characteristics of animals

Respuesta :

dancergeek22 dancergeek22

02-03-2016

A) giving animals and objects human characteristics

Answer Link

Otras preguntas

Please help ASAP will give good points an brainliest

What was the effect of the reapportionment act of 1929 on the house of representatives answers .com?

What information about the structure of the atom did rutherford's gold foil experiment provided?

The ancient remains of plants preserved in the earth in the form of coal, oil, and natural gas are called

In which sentence is the underlined pronoun in the objective case? A. Father took ~ME~ on a plane ride to take aerial photos for mapmaking. B. ~THEY~ went with

What is the ring of fire? Question 4 options: An area prone to earthquakes and wildfires. An area prone to volcanoes and earthquakes. An area reachable by inter

What was a key design change for HFC-134a A/C systems versus CFC-12 A/C systems?

Scientist have measured that the vibrations of an earthquake travel faster through solid rocks in the Earth and slower in the liquid magma deep in the Earth. T

To which of the following DNA sequences would the TATA box binding protein bind? A. TAGGCGTATATAGCGCCTTAT B. CCCGTTAATTAATTAACGCGC C. GCGCTTATCTATTACCGTACG D

Which of the following is a true statement? Land mammals such as bats, cats, dogs, cattle and mammoths became common during the Neogene Period. The first whale

Q&A Platform for Education Platform Explore for Education