saabrrinnaaa
saabrrinnaaa
07-06-2018
Mathematics
contestada
PHOTO ATTACHED.. please help
Respuesta :
tiffanylynnpete
tiffanylynnpete
12-06-2018
The correct answer is 3n-1
Answer Link
VER TODAS LAS RESPUESTAS ( 56+ )
Otras preguntas
Given below is a circle with centre O and DE is an arc of a circle with centre B. If BC=1 cm and BE=√5 cm, what is the length of OB?
Which of the following is not true about Magnetic field Lines? 1 point Are always north to side outside magnet Are always south to north inside the magnet Are a
the following claim is true or false? data normalization is important in preprocessing step, it is used to rescale values to fit in a specific range to assure b
if the strings are made of the same material, how would you expect the diameters of the lowest and highest strings to compare?
our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a cha
b) दिइएको चक्रीय चतुर्भुज ABCD मा, यदि ZABC = 95° भए ZADE को मान निकाल्नुहोस् । in the given cyclic quadrilateral ABCD if ZABC = x°, then find the measure of ZA
What is an equation of a parabola with a vertex at the origin and directrix x = 4.75? Oy=-12² 19 Oy=x² Ox=1-¹² Ox=-1² 19
Monique was one of Freud's first patients. He treated her with classic psychoanalysis. In the therapy Monique did something that Freud called transference.. Wha
an object at the origin at time has velocity measured in meters per second, when, if ever, does the object return to the origin? t/40 . see example 5 on page 23
calculate the equilibrium concentrations of reactant and products when 0.340 moles of are introduced into a 1.00 l vessel at 350. k.
Q&A Platform for Education
Platform Explore for Education
