shesnotadoctor4355 shesnotadoctor4355

07-01-2024
Physics

contestada

Convert 2,620,000 km³ of ice to km³ of water.

A) 2,312,800 km³
B) 2,489,600 km³
C) 3,505,680 km³
D) 2,620,000 km³

Respuesta :

Otras preguntas

Why does the kinetic energy change? Is it the mass or the speed that causes the change?

Determine the pOH of each solution. 1. [H3O+] = 3.3×10−10 M Express your answer using two decimal places. 2. [H3O+] = 2.6×10−7 M Express your answer using two d

Lugnow Inc. paid a sum of $76,000 to an official in the government of Nepotismia to ensure that the company obtained exclusive preferential treatment. The $76,0

A pulley requires you to pull 3 times the amount of rope in order to lift an object. Therefore, the mechanical advantage is _____. A. 1/3 B. 1 C. 3 D. 30

Select ALL the intervals where f(x)= -x^3 + 3x^2 +1 is only decreasing. -infinity < x < 1 5 < x < infinity -infinity < x < 0 -infinity < x

Which of the following is believed to contribute to children and teens' lack of sexual knowledge, beliefs about sexual myths, and poor sexual decision making? 1

Please help! Need answer ASAP!

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?

-3+ (-14) - (-2) – 4

Government by consent is really government by consensus-majority agreement in matters of opinions. What does the word consensus mean? O government O consent maj